This is “Replication and Expression of Genetic Information”, section 19.3 from the book Introduction to Chemistry: General, Organic, and Biological (v. 1.0). For details on it (including licensing), click here.

For more information on the source of this book, or why it is available for free, please see the project's home page. You can browse or download additional books there. To download a .zip file containing this book to use offline, simply click here.

Has this book helped you? Consider passing it on:
Creative Commons supports free culture from music to education. Their licenses helped make this book available to you.
DonorsChoose.org helps people like you help teachers fund their classroom projects, from art supplies to books to calculators.

19.3 Replication and Expression of Genetic Information

Learning Objectives

  1. Describe how a new copy of DNA is synthesized.
  2. Describe how RNA is synthesized from DNA.
  3. Identify the different types of RNA and the function of each type of RNA.

We previously stated that deoxyribonucleic acid (DNA) stores genetic information, while ribonucleic acid (RNA) is responsible for transmitting or expressing genetic information by directing the synthesis of thousands of proteins found in living organisms. But how do the nucleic acids perform these functions? Three processes are required: (1) replication, in which new copies of DNA are made; (2) transcription, in which a segment of DNA is used to produce RNA; and (3) translation, in which the information in RNA is translated into a protein sequence. (For more information on protein sequences, see Section 19.4 "Protein Synthesis and the Genetic Code".)

Replication

New cells are continuously forming in the body through the process of cell division. For this to happen, the DNA in a dividing cell must be copied in a process known as replicationThe process in which the DNA in a dividing cell is copied.. The complementary base pairing of the double helix provides a ready model for how genetic replication occurs. If the two chains of the double helix are pulled apart, disrupting the hydrogen bonding between base pairs, each chain can act as a template, or pattern, for the synthesis of a new complementary DNA chain.

The nucleus contains all the necessary enzymes, proteins, and nucleotides required for this synthesis. A short segment of DNA is “unzipped,” so that the two strands in the segment are separated to serve as templates for new DNA. DNA polymerase, an enzyme, recognizes each base in a template strand and matches it to the complementary base in a free nucleotide. The enzyme then catalyzes the formation of an ester bond between the 5′ phosphate group of the nucleotide and the 3′ OH end of the new, growing DNA chain. In this way, each strand of the original DNA molecule is used to produce a duplicate of its former partner (Figure 19.9 "A Schematic Diagram of DNA Replication"). Whatever information was encoded in the original DNA double helix is now contained in each replicate helix. When the cell divides, each daughter cell gets one of these replicates and thus all of the information that was originally possessed by the parent cell.

Figure 19.9 A Schematic Diagram of DNA Replication

DNA replication occurs by the sequential unzipping of segments of the double helix. Each new nucleotide is brought into position by DNA polymerase and is added to the growing strand by the formation of a phosphate ester bond. Thus, two double helixes form from one, and each consists of one old strand and one new strand, an outcome called semiconservative replications. (This representation is simplified; many more proteins are involved in replication.)

Example 1

A segment of one strand from a DNA molecule has the sequence 5′‑TCCATGAGTTGA‑3′. What is the sequence of nucleotides in the opposite, or complementary, DNA chain?

Solution

Knowing that the two strands are antiparallel and that T base pairs with A, while C base pairs with G, the sequence of the complementary strand will be 3′‑AGGTACTCAACT‑5′ (can also be written as TCAACTCATGGA).

Skill-Building Exercise

  1. A segment of one strand from a DNA molecule has the sequence 5′‑CCAGTGAATTGCCTAT‑3′. What is the sequence of nucleotides in the opposite, or complementary, DNA chain?

What do we mean when we say information is encoded in the DNA molecule? An organism’s DNA can be compared to a book containing directions for assembling a model airplane or for knitting a sweater. Letters of the alphabet are arranged into words, and these words direct the individual to perform certain operations with specific materials. If all the directions are followed correctly, a model airplane or sweater is produced.

In DNA, the particular sequences of nucleotides along the chains encode the directions for building an organism. Just as saw means one thing in English and was means another, the sequence of bases CGT means one thing, and TGC means something different. Although there are only four letters—the four nucleotides—in the genetic code of DNA, their sequencing along the DNA strands can vary so widely that information storage is essentially unlimited.

Transcription

For the hereditary information in DNA to be useful, it must be “expressed,” that is, used to direct the growth and functioning of an organism. The first step in the processes that constitute DNA expression is the synthesis of RNA, by a template mechanism that is in many ways analogous to DNA replication. Because the RNA that is synthesized is a complementary copy of information contained in DNA, RNA synthesis is referred to as transcriptionThe process in which RNA is synthesized from a DNA template..

There are three key differences between replication and transcription: (1) RNA molecules are much shorter than DNA molecules; only a portion of one DNA strand is copied or transcribed to make an RNA molecule. (2) RNA is built from ribonucleotides rather than deoxyribonucleotides. (3) The newly synthesized RNA strand does not remain associated with the DNA sequence it was transcribed from.

The DNA sequence that is transcribed to make RNA is called the template strand, while the complementary sequence on the other DNA strand is called the coding or informational strand. To initiate RNA synthesis, the two DNA strands unwind at specific sites along the DNA molecule. Ribonucleotides are attracted to the uncoiling region of the DNA molecule, beginning at the 3′ end of the template strand, according to the rules of base pairing. Thymine in DNA calls for adenine in RNA, cytosine specifies guanine, guanine calls for cytosine, and adenine requires uracil. RNA polymerase—an enzyme—binds the complementary ribonucleotide and catalyzes the formation of the ester linkage between ribonucleotides, a reaction very similar to that catalyzed by DNA polymerase (Figure 19.10 "A Schematic Diagram of RNA Transcription from a DNA Template"). Synthesis of the RNA strand takes place in the 5′ to 3′ direction, antiparallel to the template strand. Only a short segment of the RNA molecule is hydrogen-bonded to the template strand at any time during transcription. When transcription is completed, the RNA is released, and the DNA helix reforms. The nucleotide sequence of the RNA strand formed during transcription is identical to that of the corresponding coding strand of the DNA, except that U replaces T.

Figure 19.10 A Schematic Diagram of RNA Transcription from a DNA Template

The representation of RNA polymerase is proportionately much smaller than the actual molecule, which encompasses about 50 nucleotides at a time.

Example 2

A portion of the template strand of a gene has the sequence 5′‑TCCATGAGTTGA‑3′. What is the sequence of nucleotides in the RNA that is formed from this template?

Solution

Four things must be remembered in answering this question: (1) the DNA strand and the RNA strand being synthesized are antiparallel; (2) RNA is synthesized in a 5′ to 3′ direction, so transcription begins at the 3′ end of the template strand; (3) ribonucleotides are used in place of deoxyribonucleotides; and (4) thymine (T) base pairs with adenine (A), A base pairs with uracil (U; in RNA), and cytosine (C) base pairs with guanine (G). The sequence is determined to be 3′‑AGGUACUCAACU‑5′ (can also be written as 5′‑UCAACUCAUGGA‑3′).

Skill-Building Exercise

  1. A portion of the template strand of a gene has the sequence 5′‑CCAGTGAATTGCCTAT‑3′. What is the sequence of nucleotides in the RNA that is formed from this template?

Three types of RNA are formed during transcription: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA). These three types of RNA differ in function, size, and percentage of the total cell RNA (Table 19.2 "Properties of Cellular RNA in "). mRNA makes up only a small percent of the total amount of RNA within the cell, primarily because each molecule of mRNA exists for a relatively short time; it is continuously being degraded and resynthesized. The molecular dimensions of the mRNA molecule vary according to the amount of genetic information a given molecule contains. After transcription, which takes place in the nucleus, the mRNA passes into the cytoplasm, carrying the genetic message from DNA to the ribosomes, the sites of protein synthesis. In Section 19.5 "Mutations and Genetic Diseases", we shall see how mRNA directly determines the sequence of amino acids during protein synthesis.

Table 19.2 Properties of Cellular RNA in Escherichia coli

Type Function Approximate Number of Nucleotides Percentage of Total Cell RNA
mRNA codes for proteins 100–6,000 ~3
rRNA component of ribosomes 120–2900 83
tRNA adapter molecule that brings the amino acid to the ribosome 75–90 14

RibosomesA cellular substructure where proteins are synthesized. are cellular substructures where proteins are synthesized. They contain about 65% rRNA and 35% protein, held together by numerous noncovalent interactions, such as hydrogen bonding, in an overall structure consisting of two globular particles of unequal size.

Molecules of tRNA, which bring amino acids (one at a time) to the ribosomes for the construction of proteins, differ from one another in the kinds of amino acid each is specifically designed to carry. A set of three nucleotides, known as a codonA set of three nucleotides on the mRNA that specifies a particular amino acid., on the mRNA determines which kind of tRNA will add its amino acid to the growing chain. (For more information on sequences, see Section 19.4 "Protein Synthesis and the Genetic Code".) Each of the 20 amino acids found in proteins has at least one corresponding kind of tRNA, and most amino acids have more than one.

The two-dimensional structure of a tRNA molecule has three distinctive loops, reminiscent of a cloverleaf (Figure 19.11 "Transfer RNA"). On one loop is a sequence of three nucleotides that varies for each kind of tRNA. This triplet, called the anticodonA set of three nucleotides on the tRNA that is complementary to, and pairs with, the codon on the mRNA., is complementary to and pairs with the codon on the mRNA. At the opposite end of the molecule is the acceptor stem, where the amino acid is attached.

Figure 19.11 Transfer RNA

(a) In the two-dimensional structure of a yeast tRNA molecule for phenylalanine, the amino acid binds to the acceptor stem located at the 3′ end of the tRNA primary sequence. (The nucleotides that are not specifically identified here are slightly altered analogs of the four common ribonucleotides A, U, C, and G.) (b) In the three-dimensional structure of yeast phenylalanine tRNA, note that the anticodon loop is at the bottom and the acceptor stem is at the top right. (c) This shows a space-filling model of the tRNA.

Concept Review Exercises

  1. In DNA replication, a parent DNA molecule produces two daughter molecules. What is the fate of each strand of the parent DNA double helix?

  2. What is the role of DNA in transcription? What is produced in transcription?

  3. Which type of RNA contains the codon? Which type of RNA contains the anticodon?

Answers

  1. Each strand of the parent DNA double helix remains associated with the newly synthesized DNA strand.

  2. DNA serves as a template for the synthesis of an RNA strand (the product of transcription).

  3. codon: mRNA; anticodon: tRNA

Key Takeaways

  • In DNA replication, each strand of the original DNA serves as a template for the synthesis of a complementary strand.
  • DNA polymerase is the primary enzyme needed for replication.
  • In transcription, a segment of DNA serves as a template for the synthesis of an RNA sequence.
  • RNA polymerase is the primary enzyme needed for transcription.
  • Three types of RNA are formed during transcription: mRNA, rRNA, and tRNA.

Exercises

  1. Describe how replication and transcription are similar.

  2. Describe how replication and transcription differ.

  3. A portion of the coding strand for a given gene has the sequence 5′‑ATGAGCGACTTTGCGGGATTA‑3′.

    1. What is the sequence of complementary template strand?
    2. What is the sequence of the mRNA that would be produced during transcription from this segment of DNA?
  4. A portion of the coding strand for a given gene has the sequence 5′‑ATGGCAATCCTCAAACGCTGT‑3′.

    1. What is the sequence of complementary template strand?
    2. What is the sequence of the mRNA that would be produced during transcription from this segment of DNA?

Answers

  1. Both processes require a template from which a complementary strand is synthesized.

    1. 3′‑TACTCGCTGAAACGCCCTAAT‑5′
    2. 5′‑AUGAGCGACUUUGCGGGAUUA‑3′